MCP1 (CCL2) (NM_002982) Human 3' UTR Clone

CAT#: SC205217

3' UTR clone of chemokine (C-C motif) ligand 2 (CCL2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 5,464.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name MCP1 (CCL2) (NM_002982) Human 3' UTR Clone
Vector pMirTarget
Synonyms GDCF-2; HC11; HSMCR30; MCAF; MCP-1; MCP1; SCYA2; SMC-CF
ACCN NM_002982
Insert Size 394 bp
Sequence Data
>SC205217 3' UTR clone of NM_002982
The sequence shown below is from the reference sequence of NM_002982. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCTGGACAAGCAAACCCAAACTCCGAAGACTTGAACACTCACTCCACAACCCAAGAATCTGCAGCTAAC
TTATTTTCCCCTAGCTTTCCCCAGACACCCTGTTTTATTTTATTATAATGAATTTTGTTTGTTGATGTGA
AACATTATGCCTTAAGTAATGTTAATTCTTATTTAAGTTATTGATGTTTTAAGTTTATCTTTCATGGTAC
TAGTGTTTTTTAGATACAGAGACTTGGGGAAATTGCTTTTCCTCTTGAACCACAGTTCTACCCCTGGGAT
GTTTTGAGGGTCTTTGCAAGAATCATTAATACAAAGAATTTTTTTTAACATTCCAATGCATTGCTAAAAT
ATTATTGTGGAAATGAATATTTTGTAACTATTACACCAAATAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002982.3
Synonyms GDCF-2; HC11; HSMCR30; MCAF; MCP-1; MCP1; SCYA2; SMC-CF
Summary This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]
Locus ID 6347
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...