SULT1A4 (NM_001017389) Human 3' UTR Clone

CAT#: SC205199

3' UTR clone of sulfotransferase family cytosolic 1A phenol-preferring member 4 (SULT1A4) transcript variant 1



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SULT1A4 (NM_001017389) Human 3' UTR Clone
Vector pMirTarget
Synonyms aryl sulfotransferase; phenol sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
ACCN NM_001017389
Insert Size 416 bp
Sequence Data
>SC205199 3’UTR clone of NM_001017389
The sequence shown below is from the reference sequence of NM_001017389. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGGGGCTCCTGGAGTCACTGCAGAGGGAGTGTGCGAAT
CTACCCTGACCAATGGGCTCAAGAATAAAGTATGATTTTTGAGTCAGGCACAGTGGCTCATGTCTGCAA
TCCCAGCGATTTGGGAGGTTGAGCTGGTAGGATCACAATAGGCCACGAATTTGAGACCAGCCTGGTAAA
ATAGTGAGACCTCATCTCTACAAAGATGTAAAAAAATTAGCCACATGTGCTGGCACTTACCTGTAGTCC
CAGCTACTTGGGAAGCAGAGGCTGGAGGATCATTTCAGCCCAGGAGGTTGTGGATACAGTGAGTTATGA
CATGCCCATTCACTACAGCCTGGATGACAAGCAAGACCCTCCCTCCAAAGAAAATAAAGCTCAAAATAA
AA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001017389.1
Synonyms aryl sulfotransferase; phenol sulfotransferase; sulfokinase; sulfotransferase family, cytosolic, 1A, phenol-preferring, member 4
Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16, this gene and SULT1A3 arose from a segmental duplication. Read-through transcription exists between this gene and the upstream SLX1B (SLX1 structure-specific endonuclease subunit homolog B) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
Locus ID 445329
MW 15.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...