FXYD7 (NM_022006) Human 3' UTR Clone

CAT#: SC205191

3' UTR clone of FXYD domain containing ion transport regulator 7 (FXYD7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name FXYD7 (NM_022006) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_022006
Insert Size 416 bp
Sequence Data
>SC205191 3’UTR clone of NM_022006
The sequence shown below is from the reference sequence of NM_022006. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTCAGCCCCTGGTGGCGGCGGCGTGTAACACCTTCCCGAGGAAACTCCGCTGCCGACCCTGCCTGAG
CGCGGGAGCCTGAGGACCGGGTGGAGGCGGTGGGGACCCAGCCGCGCGCCGGGAGCGCTCCCCGGAATG
AGCCGCCCCACCCACCCCAAGGCTGGAGCCGCTGCACCCTGCTGTCCCTCTCCAGGCCTTGGCAATGAC
GATCCCCCAAAGAGCCCGTCTGCACCCCAGACCCAGGGCCTCAGGCCTCCAGCTCCTGGGATCCGGGAG
TCCATCCCGGCCCAGCACCCCCAGCATCCCCGTGTATGGCCCCCCTGCACCTCCTTGTCTCATCCCCGA
AGATCCGTCCCCCTGGCCCCTCAGTGTCCATGTCTTGAGCTTAATAAATGTGCATTTGGTTTTTTCCTC
TG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022006.2
Summary This reference sequence was derived from multiple replicate ESTs and validated by similar human genomic sequence. This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. This gene product, FXYD7, is novel and has not been characterized as a protein. [RefSeq curation by Kathleen J. Sweadner, Ph.D., sweadner@helix.mgh.harvard.edu., Dec 2000]
Locus ID 53822
MW 14.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...