HLAG (HLA-G) (NM_002127) Human 3' UTR Clone

CAT#: SC205157

3' UTR clone of major histocompatibility complex class I G (HLA-G) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name HLAG (HLA-G) (NM_002127) Human 3' UTR Clone
Vector pMirTarget
Synonyms MHC-G
ACCN NM_002127
Insert Size 312 bp
Sequence Data
>SC205157 3’UTR clone of NM_002127
The sequence shown below is from the reference sequence of NM_002127. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCTGTGGAGAAAGAAGAGCTCAGATTGAAAAGGAGGGAGCTACTCTCAGGCTGCAATGTGAAACAGC
TGCCCTGTGTGGGACTGAGTGGCAAGTCCCTTTGTGACTTCAAGAACCCTGACTCCTCTTTGTGCAGAG
ACCAGCCCACCCCTGTGCCCACCATGACCCTCTTCCTCATGCTGAACTGCATTCCTTCCCCAATCACCT
TTCCTGTTCCAGAAAAGGGGCTGGGATGTCTCCGTCTCTGTCTCAAATTTGTGGTCCACTGAGCTATAA
CTTACTTCTGTATTAAAATTAGAATCTGAGTATAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002127.6
Synonyms MHC-G
Summary HLA-G belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-G is expressed on fetal derived placental cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exon 6 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
Locus ID 3135
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...