ILF2 (NM_004515) Human 3' UTR Clone

CAT#: SC205153

3' UTR clone of interleukin enhancer binding factor 2 45kDa (ILF2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ILF2 (NM_004515) Human 3' UTR Clone
Vector pMirTarget
Synonyms NF45; PRO3063
ACCN NM_004515
Insert Size 369 bp
Sequence Data
>SC205153 3' UTR clone of NM_004515
The sequence shown below is from the reference sequence of NM_004515. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCATGGAAACTCAGGAGTGACATTCCCTTCACTCCTTTTCCTACCCAAGGGGGAAGACTGGAGCCTAAGC
TGCCTGCTACTGGGCTTTACATGGTGACAGACATTTCCGTGGGATAGGGAAGATAGCAGGAAGAAAAGTA
AACTCCATAGAAGTGTCATTCCACTGGGTTTTGATATTGGCTTAGCTGCCAGTCTCCCATTTGTGACCTA
TGCCATCCATCTATAATGGAGGATACCAACATTTCTTCCTAATATTCTATAATCTCCAACTCCTGAAAAC
CCCTCTCTCAACTAATACTTTGCTGTTGAAATGTTGTGAAATGTTAAGTGTCTGGAAATTTTTTTTTCTA
AGAAAAACTATTAAAGTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004515.2
Synonyms NF45; PRO3063
Summary The protein encoded by this gene is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The encoded 45 kDa protein (NF45, ILF2) forms a complex with the 90 kDa interleukin enhancer-binding factor 3 (NF90, ILF3), and this complex has been shown to affect the redistribution of nuclear mRNA to the cytoplasm, to repair DNA breaks by nonhomologous end joining, and to negatively regulate the microRNA processing pathway. Knockdown of NF45 or NF90 protein retards cell growth, possibly by inhibition of mRNA stabilization. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Dec 2014]
Locus ID 3608
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...