H2A.Z (H2AFZ) (NM_002106) Human 3' UTR Clone

CAT#: SC205093

3' UTR clone of H2A histone family member Z (H2AFZ) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name H2A.Z (H2AFZ) (NM_002106) Human 3' UTR Clone
Vector pMirTarget
Synonyms H2A.z; H2A.Z-1; H2A/z; H2AFZ; H2AZ
ACCN NM_002106
Insert Size 404 bp
Sequence Data
>SC205093 3’UTR clone of NM_002106
The sequence shown below is from the reference sequence of NM_002106. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGAAGAAAGGACAACAGAAGACTGTCTAAAGGATGCCTGGATTCCTTGTTATCTCAGGACTCTAAATA
CTCTAACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTT
TTGTAATTCTATTTGAGCAAGTTGGAAGTTTAATTAGCTTTCCAACCAACCAAATTTCTGCATTCGAGT
CTTAACCATATTTAAGTGTTACTGTGGCTTCAAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTG
AGTTGACTGTTTTTAAAAAACTGTTTGGATTTTAATTGTGATGCAGAAGTTATAGTAACAAACATTTGG
TTTTGTACAGACATTATTTCCACTCTGGTGGATAAGTTCAATAAAGGTCATATCCCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002106.4
Synonyms H2A.z; H2A.Z-1; H2A/z; H2AFZ; H2AZ
Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. [provided by RefSeq, Jul 2008]
Locus ID 3015
MW 15.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...