PPP1A (PPP1CA) (NM_206873) Human 3' UTR Clone

CAT#: SC205015

3' UTR clone of protein phosphatase 1 catalytic subunit alpha isoform (PPP1CA) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PPP1A (PPP1CA) (NM_206873) Human 3' UTR Clone
Vector pMirTarget
Synonyms PP-1A; PP1A; PP1alpha; PPP1A
ACCN NM_206873
Insert Size 382 bp
Sequence Data
>SC205015 3’UTR clone of NM_206873
The sequence shown below is from the reference sequence of NM_206873. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCCGCAATTCCGCCAAAGCCAAGAAATAGCCCCCGCACACCACCCTGTGCCCCAGATGATGGATTGAT
TGTACAGAAATCATGCTGCCATGCTGGGGGGGGGTCACCCCGACCCCTCAGGCCCACCTGTCACGGGGA
ACATGGAGCCTTGGTGTATTTTTCTTTTCTTTTTTTAATGAATCAATAGCAGCGTCCAGTCCCCCAGGG
CTGCTTCCTGCCTGCACCTGCGGTGACTGTGAGCAGGATCCTGGGGCCGAGGCTGCAGCTCAGGGCAAC
GGCAGGCCAGGTCGTGGGTCTCCAGCCGTGCTTGGCCTCAGGGCTGGCAGCCGGATCCTGGGGCAACCC
ATCTGGTCTCTTGAATAAAGGTCAAAGCTGGATTCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_206873.2
Synonyms PP-1A; PP1A; PP1alpha; PPP1A
Summary The protein encoded by this gene is one of the three catalytic subunits of protein phosphatase 1 (PP1). This broadly expressed gene encodes the alpha subunit of the PP1 complex that associates with over 200 regulatory proteins to form holoenzymes which dephosphorylate their biological targets with high specificity. PP1 is a serine/threonine specific protein phosphatase known to be involved in the regulation of a variety of cellular processes, such as cell division, glycogen metabolism, muscle contractility, protein synthesis, and HIV-1 viral transcription. Increased PP1 activity has been observed in the end stage of heart failure. Studies suggest that PP1 is an important regulator of cardiac function and that PP1 deregulation is implicated in diabetes and multiple types of cancer. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2020]
Locus ID 5499
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...