CARD9 (NM_052813) Human 3' UTR Clone

CAT#: SC204980

3' UTR clone of caspase recruitment domain family member 9 (CARD9) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CARD9 (NM_052813) Human 3' UTR Clone
Vector pMirTarget
Synonyms CANDF2; hCARD9
ACCN NM_052813
Insert Size 376 bp
Sequence Data
>SC204980 3’UTR clone of NM_052813
The sequence shown below is from the reference sequence of NM_052813. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCGACAACACCGACACTGAGGGCTCCTAGCCGCAGCAGCGCAGGCCCCGACCAGGGCACACCCACCGG
CCCGGCCTCCTGCCACCCGGGGGTGCCGACGCCCTGGGGCGCAGACTTCCCCGAGCCGTCGCTGACTTG
GCCTGGAACGAGGAATCTGGTGCCCTGAAAGGCCCAGCCGGACTGCCGGGCATTGGGGCCGTTTGTTAA
GCGGCACTCATTTTGCGGAGGCCATGCGGGTGCTCACCACCCCCATGCACACGCCATCTGTGTAACTTC
AGGATCTGTTCTGTTTCACCATGTAACACACAATACATGCATGCATTGTATTAGTGTTAGAAAACACAG
CTGCGTAAATAAACAGCACGGGTGACCCGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_052813.5
Synonyms CANDF2; hCARD9
Summary The protein encoded by this gene is a member of the CARD protein family, which is defined by the presence of a characteristic caspase-associated recruitment domain (CARD). CARD is a protein interaction domain known to participate in activation or suppression of CARD containing members of the caspase family, and thus plays an important regulatory role in cell apoptosis. This protein was identified by its selective association with the CARD domain of BCL10, a postive regulator of apoptosis and NF-kappaB activation, and is thought to function as a molecular scaffold for the assembly of a BCL10 signaling complex that activates NF-kappaB. Several alternatively spliced transcript variants have been observed, but their full-length nature is not clearly defined. [provided by RefSeq, Jul 2008]
Locus ID 64170
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...