ARPC1A (NM_006409) Human 3' UTR Clone

CAT#: SC204826

3' UTR clone of actin related protein 2/3 complex subunit 1A 41kDa (ARPC1A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name ARPC1A (NM_006409) Human 3' UTR Clone
Vector pMirTarget
Synonyms Arc40; HEL-68; HEL-S-307; SOP2Hs; SOP2L
ACCN NM_006409
Insert Size 363 bp
Sequence Data
>SC204826 3’UTR clone of NM_006409
The sequence shown below is from the reference sequence of NM_006409. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTTCCATCCAGGGCCTCCGGATAATGTGAAGCTGAGTGAGCCTCCGCCATCCAGCATGACAAACTGTG
GCCGACCGCAGCTGTGCCGTGGCACGATGGCGAGGAAGCCAGCCCCAAGGAAACACTGAAAACACATAT
CACGCCAATGCCGTGTGGTTTTGTTTGAATATAAAATTGGTGAAAGTGTTGGTTTTTTTAAGGCAGTAA
TTTTTTTGTTTGTTTTTTTGCGATTTCATTCCATTCTTGACCAAAGCTTCTCTTTAAGTAGTTTATTAT
GGAAAATTGTCACACTAACTTAAAAGACAGGGTGAGGGAGATATGTAAATTGTCCACTAGAAAATTAAA
TAAAAGAACTGAATGTGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006409.4
Synonyms Arc40; HEL-68; HEL-S-307; SOP2Hs; SOP2L
Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Locus ID 10552
MW 14
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...