C11orf73 (HIKESHI) (NM_016401) Human 3' UTR Clone

CAT#: SC204768

3' UTR clone of chromosome 11 open reading frame 73 (C11orf73) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name C11orf73 (HIKESHI) (NM_016401) Human 3' UTR Clone
Vector pMirTarget
Synonyms C11orf73; HLD13; HSPC138; HSPC179; L7RN6; OPI10
ACCN NM_016401
Insert Size 335 bp
Sequence Data
>SC204768 3’UTR clone of NM_016401
The sequence shown below is from the reference sequence of NM_016401. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCACAGAACCCTCTCTTTTGGAAAACATAATTTGAATAAAATAATTTTTAATGGATTCTGAAATTTGTC
ATGTTTTGAAGATAACTGACTCCATCTAAAAGTATGAGGTCAAAGGATCACGAAACCTAAGTTTAAAAA
CTGCTTAGAGACTGAAGCTTAATTAAAAATCTTTATTAAAAATTAAAAACATTGAAAAATGAAAATATG
TTCATCATTAAAGACTTTTTTCCCCTTAAGCTTAAAATACCATTCAAAGGCAAGACATTTTGTTTTGGC
TATGATTCATTTTTTTTACTTAAAAATAAAACCTATACCAAACAGTAGTGTGCCAAGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016401.4
Synonyms C11orf73; HLD13; HSPC138; HSPC179; L7RN6; OPI10
Summary This gene encodes an evolutionarily conserved nuclear transport receptor that mediates heat-shock-induced nuclear import of 70 kDa heat-shock proteins (Hsp70s) through interactions with FG-nucleoporins. The protein mediates transport of the ATP form but not the ADP form of Hsp70 proteins under conditions of heat shock stress. Structural analyses demonstrate that the protein forms an asymmetric homodimer and that the N-terminal domain consists of a jelly-roll/beta-sandwich fold structure that contains hydrophobic pockets involved in FG-nucleoporin recognition. Reduction of RNA expression levels in HeLa cells using small interfering RNAs results in inhibition of heat shock-induced nuclear accumulation of Hsp70s, indicating a role for this gene in regulation of Hsp70 nuclear import during heat shock stress. [provided by RefSeq, Apr 2016]
Locus ID 51501
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...