LILRA5 (NM_021250) Human 3' UTR Clone

CAT#: SC204609

3' UTR clone of leukocyte immunoglobulin-like receptor subfamily A (with TM domain) member 5 (LILRA5) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name LILRA5 (NM_021250) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD85; CD85F; ILT-11; ILT11; LILRB7; LIR-9; LIR9
ACCN NM_021250
Insert Size 373 bp
Sequence Data
>SC204609 3’UTR clone of NM_021250
The sequence shown below is from the reference sequence of NM_021250. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAAGCCCCCAAGCTGCAGCTGGAAGGTGAACAGAAGAGAGAACAATGCACCATTGAATGCTGGAGCCT
TGGAAGCGAATCTGATGGTCCTAGGAGGTTCGGGAAGACCATCTGAGGCCTATGCCATCTGGACTGTCT
GCTGGCAATTTCTTTTTTTCTTTCTTTTCTTTTCTTTCTTTTTTTTTTTTTTTTTTTTTTTTGAGATGG
AGTCTTGCTCTGTCACCAGGCTGGAATGCAGTGGCGCAATCTGGGCTCACTGCAACCTCCGCCTCTCGG
GTTCAAGTGATTCTCCTGCCTCAGCCTCTGGCAATTTCTAGAGGGAGGAATGGGTGTTTGAGTGCAGAG
ACACTGGTCTGGGGTGATCCATGGAGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021250.4
Synonyms CD85; CD85F; ILT-11; ILT11; LILRB7; LIR-9; LIR9
Summary The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 353514
MW 14.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...