MRPS12 (NM_033363) Human 3' UTR Clone

CAT#: SC204474

3' UTR clone of mitochondrial ribosomal protein S12 (MRPS12) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name MRPS12 (NM_033363) Human 3' UTR Clone
Vector pMirTarget
Synonyms MPR-S12; MT-RPS12; RPMS12; RPS12; RPSM12
ACCN NM_033363
Insert Size 367 bp
Sequence Data
>SC204474 3’UTR clone of NM_033363
The sequence shown below is from the reference sequence of NM_033363. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACGACTGTGGCCACGTGCAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTGGGCGCCCCTGCAGAACA
TGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGAGGCAGCCACT
CATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCACTATTAAGCCATAGGAGTCCTGGGGGTG
CAAAGGGTGCCCCTCTGTCAACACCCTTGGCTCCTGTGTTTAGAGGGGTGGCCTGAAGGACCTTTTCTG
CTGGGACAAGACACTGTACTGCCCTCTGCTGGGAAGGGGTTTTAATAAACAGACCCTGGCGCTTGTGAT
GTAAAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033363.1
Synonyms MPR-S12; MT-RPS12; RPMS12; RPS12; RPSM12
Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S12P family. The encoded protein is a key component of the ribosomal small subunit and controls the decoding fidelity and susceptibility to aminoglycoside antibiotics. The gene for mitochondrial seryl-tRNA synthetase is located upstream and adjacent to this gene, and both genes are possible candidates for the autosomal dominant deafness gene (DFNA4). Splice variants that differ in the 5' UTR have been found for this gene; all three variants encode the same protein. [provided by RefSeq, Jul 2008]
Locus ID 6183
MW 13.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...