CD48 (NM_001778) Human 3' UTR Clone

CAT#: SC204446

3' UTR clone of CD48 molecule (CD48) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD48 (NM_001778) Human 3' UTR Clone
Vector pMirTarget
Synonyms BCM1; BLAST; BLAST1; hCD48; mCD48; MEM-102; SLAMF2
ACCN NM_001778
Insert Size 336 bp
Sequence Data
>SC204446 3’UTR clone of NM_001778
The sequence shown below is from the reference sequence of NM_001778. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCACCATTCTTGGCCTGTTACTTACCTGAGATGAGCTCTTTTAACTCAAGCGAAACTTCAAGGCCAGA
AGATCTTGCCTGTTGGTGATCATGCTCCTCACCAGGACAGAGACTGTATAGGCTGACCAGAAGCATGCT
GCTGAATTATCAACGAGGATTTTCAAGTTAACTTTTAAATACTGGTTATTATTTAATTTTATATCCCTT
TGTTGTTTTCTAGTACACAGAGATATAGAGATACACATGCTTTTTTCCCACCCAAAATTGTGACAACAT
TATGTGAATGTTTTATTATTTTTTAAAATAAACATTTGATATAATTGTCAATTAACTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001778.4
Synonyms BCM1; BLAST; BLAST1; hCD48; mCD48; MEM-102; SLAMF2
Summary This gene encodes a member of the CD2 subfamily of immunoglobulin-like receptors which includes SLAM (signaling lymphocyte activation molecules) proteins. The encoded protein is found on the surface of lymphocytes and other immune cells, dendritic cells and endothelial cells, and participates in activation and differentiation pathways in these cells. The encoded protein does not have a transmembrane domain, however, but is held at the cell surface by a GPI anchor via a C-terminal domain which maybe cleaved to yield a soluble form of the receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Locus ID 962
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...