Topoisomerase II beta (TOP2B) (NM_001068) Human 3' UTR Clone

CAT#: SC204287

3' UTR clone of topoisomerase (DNA) II beta 180kDa (TOP2B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Topoisomerase II beta (TOP2B) (NM_001068) Human 3' UTR Clone
Vector pMirTarget
Synonyms top2beta; TOPIIB
ACCN NM_001068
Insert Size 449 bp
Sequence Data
>SC204287 3’UTR clone of NM_001068
The sequence shown below is from the reference sequence of NM_001068. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGATGTTGATTTTGCAATGTTTAATTAAGTGCCCAAAGAGCACAAACATTTTTCAACAAATATCTTG
TGTTGTCCTTTTGTCTTCTCTGTCTCAGACTTTTGTACATCTGGCTTATTTTAATGTGATGATGTAATT
GACGGTTTTTTATTATTGTGGTAGGCCTTTTAACATTTTGTTCTTACACATACAGTTTTATGCTCTTTT
TTACTCATTGAAATGTCACGTACTGTCTGATTGGCTTGTAGAATTGTTATAGACTGCCGTGCATTAGCA
CAGATTTTAATTGTCATGGTTACAAACTACAGACCTGCTTTTTGAAATGAAATTTAAACATTAAAAATG
GAACTGTGTTCTCTGTCTCTTTACTGAAGATAAAGGTGTAGTAAAAGCTCCCACACACCTTTAAAATAA
ATATATTTTATTCTTTGCAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001068.3
Synonyms top2beta; TOPIIB
Summary This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
Locus ID 7155
MW 17.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...