Macrophage Inflammatory Protein 1 beta (CCL4L2) (NM_001001435) Human 3' UTR Clone

CAT#: SC204190

3' UTR clone of chemokine (C-C motif) ligand 4-like 1 (CCL4L1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name Macrophage Inflammatory Protein 1 beta (CCL4L2) (NM_001001435) Human 3' UTR Clone
Vector pMirTarget
Synonyms AT744.2; CCL4L; LAG-1; LAG1; SCYA4L
ACCN NM_001001435
Insert Size 349 bp
Sequence Data
>SC204190 3’UTR clone of NM_001001435
The sequence shown below is from the reference sequence of NM_001001435. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTACGTGTATGACCTGGAACTGAACTGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTG
AGCCTGGATGCTTCTCCATGAGCCGCATCTCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCTCT
TCTCTTAATGTAATCTCTTTTATGTGCTGTATTATTGTATTAGGTGTTATTTCCATTATTTATATTAGT
TTAGCCAAAGGATAAGTGTCCCCTATGGGGATGGTCCACTCTCACTCTTTCTCTGCTGTTGCAAATACA
TGGATAACACCGTTAATTCCATGTGTTTTCATAATAAAACTTTAAAATAAAATGCAAAAAAAAAAAAAA
AAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001001435.2
Synonyms AT744.2; CCL4L; LAG-1; LAG1; SCYA4L
Summary This gene is one of several cytokine genes that are clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins that function in inflammatory and immunoregulatory processes. The protein encoded by this family member is similar to the chemokine (C-C motif) ligand 4 product, which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals, where most individuals have one to five copies. This gene copy contains a non-consensus splice acceptor site at the 3' terminal exon found in other highly similar gene copies, and it thus uses other alternative splice sites for the 3' terminal exon, resulting in multiple transcript variants. [provided by RefSeq, Apr 2014]
Locus ID 9560
MW 12.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Macrophage Inflammatory Protein 1 beta产品

Customer Reviews 
Loading...