ARPC1B (NM_005720) Human 3' UTR Clone

CAT#: SC204111

3' UTR clone of actin related protein 2/3 complex subunit 1B 41kDa (ARPC1B) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ARPC1B (NM_005720) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARC41; IMD71; p40-ARC; p41-ARC; PLTEID
ACCN NM_005720
Insert Size 357 bp
Sequence Data
>SC204111 3’UTR clone of NM_005720
The sequence shown below is from the reference sequence of NM_005720. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGCCTTGAAGGACCTCAAGATCAAATGACCTGTGAGGAATATGTTGCCTTCATCCTAGCTGCTGGGG
AAGCGGGGAGAGGGGTCAGGGAGGCTAATGGTTGCTTTGCTGAATGTTTCTGGGGTACCAATACGAGTT
CCCATAGGGGCTGCTCCCTCAAAAAGGGAGGGGACAGATGGGGAGCTTTTCTTACCTATTCAAGGAATA
CGTGCCTTTTTCTTAAATGCTTTCATTTATTGAAAAAAAAAAAAAATGCCCCCAAAGCACTATGCTGGT
CATGAACTGCTTCAAAATGTGGAGGTAATAAAATGCAACTGTGTAAAAAAAAAAAAAAAAAAAAAAGTA
ATTATGGACATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005720.4
Synonyms ARC41; IMD71; p40-ARC; p41-ARC; PLTEID
Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Locus ID 10095
MW 13.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...