CD42c (GP1BB) (NM_000407) Human 3' UTR Clone

CAT#: SC204067

3' UTR clone of glycoprotein Ib (platelet) beta polypeptide (GP1BB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD42c (GP1BB) (NM_000407) Human 3' UTR Clone
Vector pMirTarget
Synonyms BDPLT1; BS; CD42C; GPIBB; GPIbbeta
ACCN NM_000407
Insert Size 337 bp
Sequence Data
>SC204067 3’UTR clone of NM_000407
The sequence shown below is from the reference sequence of NM_000407. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGAGCGAGCCGGAACCGACGAGTCCTGAGGAGAGAACCGGTGCGTCCTGAGGAGAGAACCGGCGCTG
GGCAACACGGGCCTGCAAACTCGACAGGACCCTGCCCGAGGGGCCCTCGCGCCAACCTGGACCGGTCCC
CGCCTCCTCCGCTGCCCAATCTCTCAGACCCACCCCACCTGCAGGCCCAGACCACGTGGGACAGAACTC
CTGCCCACCCTACCCCGAGGGAGGCGAACCCGCACTTCCAGGCTTGGGAGGACCATGGGGCACAATGCG
GTCCAGACCCTGCTGCGTCTCCCTTCCAAACTCTGGTGCTGAATAAACCCTTCTGATCTGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000407.5
Synonyms BDPLT1; BS; CD42C; GPIBB; GPIbbeta
Summary Platelet glycoprotein Ib (GPIb) is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. It is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (VWF), and mediates platelet adhesion in the arterial circulation. GPIb alpha chain provides the VWF binding site, and GPIb beta contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. Mutations in the GPIb beta subunit have been associated with Bernard-Soulier syndrome, velocardiofacial syndrome and giant platelet disorder. The 206 amino acid precursor of GPIb beta is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. A 411 amino acid protein arising from a longer, unspliced transcript in endothelial cells has been described; however, the authenticity of this product has been questioned. Yet another less abundant GPIb beta mRNA species of 3.5 kb, expressed in nonhematopoietic tissues such as endothelium, brain and heart, was shown to result from inefficient usage of a non-consensus polyA signal in the neighboring upstream gene (SEPT5, septin 5). In the absence of polyadenylation from its own imperfect site, the SEPT5 gene produces read-through transcripts that use the consensus polyA signal of this gene. [provided by RefSeq, Dec 2010]
Locus ID 2812
MW 12.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...