Protein C (PROC) (NM_000312) Human 3' UTR Clone

CAT#: SC204063

3' UTR clone of protein C (inactivator of coagulation factors Va and VIIIa) (PROC) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Protein C (PROC) (NM_000312) Human 3' UTR Clone
Vector pMirTarget
Synonyms APC; PC; PROC1; THPH3; THPH4
ACCN NM_000312
Insert Size 326 bp
Sequence Data
>SC204063 3’UTR clone of NM_000312
The sequence shown below is from the reference sequence of NM_000312. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGCCCCCCAGAAGAGCTGGGCACCTTAGCGACCCTCCCTGCAGGGCTGGGCTTTTGCATGGCAATGG
ATGGGACATTAAAGGGACATGTAACAAGCACACCGGCCTGCTGTTCTGTCCTTCCATCCCTCTTTTGGG
CTCTTCTGGAGGGAAGTAACATTTACTGAGCACCTGTTGTATGTCACATGCCTTATGAATAGAATCTTA
ACTCCTAGAGCAACTCTGTGGGGTGGGGAGGAGCAGATCCAAGTTTTGCGGGGTCTAAAGCTGTGTGTG
TTGAGGGGGATACTCTGTTTATGAAAAAGAATAAAAAACACAACCACGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000312.4
Synonyms APC; PC; PROC1; THPH3; THPH4
Summary This gene encodes a vitamin K-dependent plasma glycoprotein. The encoded protein is cleaved to its activated form by the thrombin-thrombomodulin complex. This activated form contains a serine protease domain and functions in degradation of the activated forms of coagulation factors V and VIII. Mutations in this gene have been associated with thrombophilia due to protein C deficiency, neonatal purpura fulminans, and recurrent venous thrombosis.[provided by RefSeq, Dec 2009]
Locus ID 5624
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...