Caspase 10 (CASP10) (NM_032974) Human 3' UTR Clone

CAT#: SC203977

3' UTR clone of caspase 10 apoptosis-related cysteine peptidase (CASP10) transcript variant B for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Caspase 10 (CASP10) (NM_032974) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALPS2; FLICE-2; FLICE2; MCH4
ACCN NM_032974
Insert Size 353 bp
Sequence Data
>SC203977 3’UTR clone of NM_032974
The sequence shown below is from the reference sequence of NM_032974. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCATGCGCAGGTGGAGCAGCGTTTCCTAGTTCTTTCCAGAGGCTTCCTTCTGCCTGCCTTCCAGCCAC
ATCGCCTGAGATTGACAACGCCCTACAGCAAGACGGAAACCTCCCTTTACAGCACCACCTTGCGATTCT
GCAGCCACAAAGTTGAGACTTCTGAACGTGGCACTCTTCTGTTCCCTTACTGTTTCACGTGTACCTGTG
TCATCTTTCTTGTTTCATCGTAAACATACTTCTAAAATTCCCATTTTCTTTATTTAGAAATAGAACTAC
AAGCGGATGGTTAAACAATTTAAACAAATGGTCCATGGGGAAAAGTGAATTTCACACTGTCCCCCAAAC
TTTCAGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032974.5
Synonyms ALPS2; FLICE-2; FLICE2; MCH4
Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]
Locus ID 843
MW 13.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...