MEK2 (MAP2K2) (NM_030662) Human 3' UTR Clone

CAT#: SC203958

3' UTR clone of mitogen-activated protein kinase kinase 2 (MAP2K2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MEK2 (MAP2K2) (NM_030662) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFC4; MAPKK2; MEK2; MKK2; PRKMK2
ACCN NM_030662
Insert Size 307 bp
Sequence Data
>SC203958 3’UTR clone of NM_030662
The sequence shown below is from the reference sequence of NM_030662. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCGGCACACCCACGCGCACCGCCGTGTGACAGTGGCCGGGCTCCCTGCGTCCCGCTGGTGACCTGCCC
ACCGTCCCTGTCCATGCCCCGCCCTTCCAGCTGAGGACAGGCTGGCGCCTCCACCCACCCTCCTGCCTC
ACCCCTGCGGAGAGCACCGTGGCGGGGCGACAGCGCATGCAGGAACGGGGGTCTCCTCTCCTGCCCGTC
CTGGCCGGGGTGCCTCTGGGGACGGGCGACGCTGCTGTGTGTGGTCTCAGAGGCTCTGCTTCCTTAGGT
TACAAAACAAAACAGGGAGAGAAAAAGCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_030662.4
Synonyms CFC4; MAPKK2; MEK2; MKK2; PRKMK2
Summary The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 5605
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...