NR1D1 (NM_021724) Human 3' UTR Clone

CAT#: SC203850

3' UTR clone of nuclear receptor subfamily 1 group D member 1 (NR1D1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NR1D1 (NM_021724) Human 3' UTR Clone
Vector pMirTarget
Synonyms ear-1; EAR1; hRev; REVERBA; REVERBalpha; THRA1; THRAL
ACCN NM_021724
Insert Size 320 bp
Sequence Data
>SC203850 3’UTR clone of NM_021724
The sequence shown below is from the reference sequence of NM_021724. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCTGTCCTTCCGGGTGGACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTGCCCCCTTGTACAG
AATCGAACTCTGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAATCTTATTTATAT
TGTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTGCCTCCCTCCCC
CATCACCGAACTTCCCCTCCTCCCCTATTTAAACCACTCTGTCTCCCCCACAACCCTCCCCTGGCCCTC
TGATTTGTTCTGTTCCTGTCTCAAATCCAATAGTTCACAGCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021724.5
Synonyms ear-1; EAR1; hRev; REVERBA; REVERBalpha; THRA1; THRAL
Summary This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (ARNTL). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Jan 2013]
Locus ID 9572
MW 12.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...