CHCHD2 (NM_016139) Human 3' UTR Clone

CAT#: SC203840

3' UTR clone of coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CHCHD2 (NM_016139) Human 3' UTR Clone
Vector pMirTarget
Synonyms C7orf17; MIX17B; MNRR1; NS2TP; PARK22
ACCN NM_016139
Insert Size 308 bp
Sequence Data
>SC203840 3’UTR clone of NM_016139
The sequence shown below is from the reference sequence of NM_016139. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGTGCCGACTTGCAAACGGATTGGCCTAATGAAGAAGTTCAACCTGGAGAGATGGAAAATCAGCTCTC
ATAACTAAGTTAATTTAGTATAAAAATAGAATTGATAGTGAGGGTATAAAGTGTAACCATCAGTTAAAC
CTCTCCTGTCATTCCTGGCTTCCTTGCTTCAGAATTGAAATGGAAGTGGGGGTGTCCCTACTCTGTAGA
ATCTGGGACTGGGCAAATGTTTGTGTGGCCTCCTTAAACTAGCTGTTATGTTATGATTTTATTCTTTGT
GAGTTAATTAGAATAAAGTCATTTTCTTCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016139.4
Synonyms C7orf17; MIX17B; MNRR1; NS2TP; PARK22
Summary The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 51142
MW 11.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...