SNRPB (NM_003091) Human 3' UTR Clone

CAT#: SC203838

3' UTR clone of small nuclear ribonucleoprotein polypeptides B and B1 (SNRPB) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SNRPB (NM_003091) Human 3' UTR Clone
Vector pMirTarget
Synonyms CCMS; COD; Sm-B/B'; SmB/B'; SmB/SmB'; snRNP-B; SNRPB1
ACCN NM_003091
Insert Size 317 bp
Sequence Data
>SC203838 3’UTR clone of NM_003091
The sequence shown below is from the reference sequence of NM_003091. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTCCCCCTGGGATGCGAGGCCTTCTTTGACCCTTGGCCACAGAGTATGGAAGTAGCTCCGCAGAGGCG
TGGGCTCGATTCCTCAGGGCCACGTTACCACAGACCTGTTTGTTTCTTATGCTGTTGTTCGTGGAGTCT
CATGGGATTGTCTGGTTTCCCTTACAGGGCCCCCTCCCCCGGGAATGCGCCCACCAAGGCCCTAGACTC
ATCTTGGCCCTCCTCAGCTCCCTGCCTGTTTCCCGTAAGGCTGTACATAGTCCTTTTATCTCCTTGTGG
CCTATGAAACTGGTTTATAATAAACTCTTAAGAGAACATTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003091.4
Synonyms CCMS; COD; Sm-B/B'; SmB/B'; SmB/SmB'; snRNP-B; SNRPB1
Summary The protein encoded by this gene is one of several nuclear proteins that are found in common among U1, U2, U4/U6, and U5 small ribonucleoprotein particles (snRNPs). These snRNPs are involved in pre-mRNA splicing, and the encoded protein may also play a role in pre-mRNA splicing or snRNP structure. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding different isoforms (B and B') have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 6628
MW 11.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...