CYP2F1 (NM_000774) Human 3' UTR Clone

CAT#: SC203830

3' UTR clone of cytochrome P450 family 2 subfamily F polypeptide 1 (CYP2F1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name CYP2F1 (NM_000774) Human 3' UTR Clone
Vector pMirTarget
Synonyms C2F1; CYP2F; CYPIIF1
ACCN NM_000774
Insert Size 329 bp
Sequence Data
>SC203830 3’UTR clone of NM_000774
The sequence shown below is from the reference sequence of NM_000774. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTTTCCAGCTGTGCCTGCGCCCGCGCTAACGCCCCGGCCCTTCCAGATTCGCCTGTGAGCGATGAGGC
CCGCCCATGCGGGTTGCTACGTCCCCTTCTTGGTCCACAGTCTGCCCTCATCCCTCTGGCAGTCACGCT
GTCTTCCCTGCATGCTGTGCCTGCCGCGTGCCCTTCCCCCATCCCTCCAATCTGTGCCCCGTCTGCAGG
GCAGAGGCAGATGTGGCATGTCTTTTTGTACCCACAGAGCTTGTTCTATGGCACGCCCTTTTCTAGGCT
TTTTGTATCATTTCTTAGTACATTGTAATAGATTCAAACCAGTCTTGGCTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000774.5
Synonyms C2F1; CYP2F; CYPIIF1
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is known to dehydrogenate 3-methylindole, an endogenous toxin derived from the fermentation of tryptophan, as well as xenobiotic substrates such as naphthalene and ethoxycoumarin. This gene is part of a large cluster of cytochrome P450 genes from the CYP2A, CYP2B and CYP2F subfamilies on chromosome 19q. [provided by RefSeq, Jul 2008]
Locus ID 1572
MW 12.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...