DNAAF4 (NM_001033560) Human 3' UTR Clone

CAT#: SC203817

3' UTR clone of dyslexia susceptibility 1 candidate 1 (DYX1C1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name DNAAF4 (NM_001033560) Human 3' UTR Clone
Vector pMirTarget
Synonyms CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD
ACCN NM_001033560
Insert Size 310 bp
Sequence Data
>SC203817 3’UTR clone of NM_001033560
The sequence shown below is from the reference sequence of NM_001033560. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCTGCACGTATACATCCAGATGGCCTGAAGCAAGTGAAGAATCACAAAAGAAGTGAAAATGGCCGGT
TCCTGCCTTAACTGATGACATTACCTTGTGAAATTCCTTCTCCTGGCTCAGAACCTCCCCCACTGAGCA
CCTTGTGACCCCTGCCCCTGCCCGCCACAGAATAACCCCCTTTGACTGTAATTTTCCATTACCTACCCA
AATCCTATAAAACGGCCCCACCCCTATCTCCCTTCGCTGACTGTCTTTTCGGACTCAGCCCGCCTCCAC
CCAGGTGATTAAAAAGCTTTATTGCTCACACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001033560.2
Synonyms CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD
Summary This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011]
Locus ID 161582
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...