KiSS1 receptor (KISS1R) (NM_032551) Human 3' UTR Clone

CAT#: SC203790

3' UTR clone of KISS1 receptor (KISS1R) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 2 publications.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name KiSS1 receptor (KISS1R) (NM_032551) Human 3' UTR Clone
Vector pMirTarget
Synonyms AXOR12; CPPB1; GPR54; HH8; HOT7T175; KISS-1R
ACCN NM_032551
Insert Size 287 bp
Sequence Data
>SC203790 3’UTR clone of NM_032551
The sequence shown below is from the reference sequence of NM_032551. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCTGGGGGAGGACAACGCCCCTCTCTGAGCGGACCCGGTGGGAATCCGAGCGGCTCCCTCGGGAGCG
GGGACTGCTGGAACAGCGGCTATTCTTCTGTTATTAGTATTTTTCTTACTGTCCAAGATCAACTGTGGA
AATATTTTGGTCTCTTGTGACGTTCGGTGCAGTTTCGTTGTGAAGTTTGCTATTGATATTGAAATTATG
ACTTCTGTGTTTCCTGAAATTAAACATGTGTCAACACAGGACTTTCTGGATCATTCCAGAAAGTGTCAG
ACGTTTTCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032551.5
Synonyms AXOR12; CPPB1; GPR54; HH8; HOT7T175; KISS-1R
Summary The protein encoded by this gene is a galanin-like G protein-coupled receptor that binds metastin, a peptide encoded by the metastasis suppressor gene KISS1. The tissue distribution of the expressed gene suggests that it is involved in the regulation of endocrine function, and this is supported by the finding that this gene appears to play a role in the onset of puberty. Mutations in this gene have been associated with hypogonadotropic hypogonadism and central precocious puberty. [provided by RefSeq, Jul 2008]
Locus ID 84634
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents

Customer Reviews 
Loading...