SUPT5H (NM_001111020) Human 3' UTR Clone

CAT#: SC203787

3' UTR clone of suppressor of Ty 5 homolog (S. cerevisiae) (SUPT5H) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SUPT5H (NM_001111020) Human 3' UTR Clone
Vector pMirTarget
Synonyms SPT5; SPT5H; Tat-CT1
ACCN NM_001111020
Insert Size 301 bp
Sequence Data
>SC203787 3’UTR clone of NM_001111020
The sequence shown below is from the reference sequence of NM_001111020. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTTCCTGGGGAAGCTCCTGGAAGCCTGAAGCAGGCAGGGCCGGTGGACTTCGTCGGATGAAGAGTGA
TCCTCCTTCCTTCCCTGGCCCTTGGCTGTGACACAAGATCCTCCTGCAGGGCTAGGCGGATTGTTCTGG
ATTTCCTTTTGTTTTTCCTTTTAGTTTTCCATCTTTTCCCTCCCTGGTGCTCATTGGAATCTGAGTAGA
GTCTGGGGGAGGGTCCCCACCTTCCTGTACCTCCTCCCCACAGCTTGCTTTTGTTGTACCGTCTTTCAA
TAAAAAGAAGCTGTTTGGTCTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001111020.3
Synonyms SPT5; SPT5H; Tat-CT1
Summary Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites. DSIF can also positively regulate transcriptional elongation and is required for the efficient activation of transcriptional elongation by the HIV-1 nuclear transcriptional activator, Tat. DSIF acts to suppress transcriptional pausing in transcripts derived from the HIV-1 LTR and blocks premature release of HIV-1 transcripts at terminator sequences.[UniProtKB/Swiss-Prot Function]
Locus ID 6829
MW 11.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...