SHP1 (PTPN6) (NM_080548) Human 3' UTR Clone

CAT#: SC203781

3' UTR clone of protein tyrosine phosphatase non-receptor type 6 (PTPN6) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SHP1 (PTPN6) (NM_080548) Human 3' UTR Clone
Vector pMirTarget
Synonyms HCP; HCPH; HPTP1C; PTP-1C; SH-PTP1; SHP-1; SHP-1L; SHP1
ACCN NM_080548
Insert Size 246 bp
Sequence Data
>SC203781 3’UTR clone of NM_080548
The sequence shown below is from the reference sequence of NM_080548. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAGCAAGGGTTCCCTCAAGAGGAAGTGAGCGGTGCTGTCCTCAGGTGGCCATGCCTCAGCCCTGACC
CTGTGGAAGCATTTCGCGATGGACAGACTCACAACCTGAACCTAGGAGTGCCCCATTCTTTTGTAATTT
AAATGGCTGCATCCCCCCCACCTCTCCCTGACCCTGTATATAGCCCAGCCAGGCCCCAGGCAGGGCCAA
CCCTTCTCCTCTTGTAAATAAAGCCCTGGGATCACTGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080548.5
Synonyms HCP; HCPH; HPTP1C; PTP-1C; SH-PTP1; SHP-1; SHP-1L; SHP1
Summary The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. N-terminal part of this PTP contains two tandem Src homolog (SH2) domains, which act as protein phospho-tyrosine binding domains, and mediate the interaction of this PTP with its substrates. This PTP is expressed primarily in hematopoietic cells, and functions as an important regulator of multiple signaling pathways in hematopoietic cells. This PTP has been shown to interact with, and dephosphorylate a wide spectrum of phospho-proteins involved in hematopoietic cell signaling. Multiple alternatively spliced variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
Locus ID 5777
MW 9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...