SERPING1 (NM_001032295) Human 3' UTR Clone

CAT#: SC203762

3' UTR clone of serpin peptidase inhibitor clade G (C1 inhibitor) member 1 (SERPING1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SERPING1 (NM_001032295) Human 3' UTR Clone
Vector pMirTarget
Synonyms C1IN; C1INH; C1NH; HAE1; HAE2
ACCN NM_001032295
Insert Size 297 bp
Sequence Data
>SC203762 3’UTR clone of NM_001032295
The sequence shown below is from the reference sequence of NM_001032295. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGGGCGAGTATATGACCCCAGGGCCTGAGACCTGCAGGATCAGGTTAGGGCGAGCGCTACCTCTCCA
GCCTCAGCTCTCAGTTGCAGCCCTGCTGCTGCCTGCCTGGACTTGGCCCCTGCCACCTCCTGCCTCAGG
TGTCCGCTATCCACCAAAAGGGCTCCCTGAGGGTCTGGGCAAGGGACCTGCTTCTATTAGCCCTTCTCC
ATGGCCCTGCCATGCTCTCCAAACCACTTTTTGCAGCTTTCTCTAGTTCAAGTTCACCAGACTCTATAA
ATAAAACCTGACAGACCATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001032295.2
Synonyms C1IN; C1INH; C1NH; HAE1; HAE2
Summary This gene encodes a highly glycosylated plasma protein involved in the regulation of the complement cascade. Its encoded protein, C1 inhibitor, inhibits activated C1r and C1s of the first complement component and thus regulates complement activation. It is synthesized in the liver, and its deficiency is associated with hereditary angioneurotic oedema (HANE). Alternative splicing results in multiple transcript variants encoding the same isoform. [provided by RefSeq, May 2020]
Locus ID 710
MW 10.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...