NT5C (NM_014595) Human 3' UTR Clone

CAT#: SC203744

3' UTR clone of 5' 3'-nucleotidase cytosolic (NT5C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NT5C (NM_014595) Human 3' UTR Clone
Vector pMirTarget
Synonyms cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2
ACCN NM_014595
Insert Size 290 bp
Sequence Data
>SC203744 3’UTR clone of NM_014595
The sequence shown below is from the reference sequence of NM_014595. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCAAGCGCGGAGCTGCGCAGCGGGAATGAGCGGGGATGCCGCGGGCAGCAGCTGGAGCTAAAGGAAGG
GCAGGCCCACAGGGGCCACCGCAGAGCCGAGTCGGGGCGGCATCGTGCTGGTGCCTCTGGCCCCGTGGA
GTGGAGCAGGCAGATACCGTTAAGCGCTGTGCTACCGGGCCCCAGGCCCAGCCACCCGGTACCTCCCGA
GAGGCTGTCCCTGGACCCTGGCTGGCATGGAAATACAGTGGGAAAACCAGTCGGGACCTTTAATAAAAG
ACCTTGGCTTTCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014595.3
Synonyms cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2
Summary This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
Locus ID 30833
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...