Phospholipase A2 IIA (PLA2G2A) (NM_001161729) Human 3' UTR Clone

CAT#: SC203698

3' UTR clone of phospholipase A2 group IIA (platelets synovial fluid) (PLA2G2A) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Phospholipase A2 IIA (PLA2G2A) (NM_001161729) Human 3' UTR Clone
Vector pMirTarget
Synonyms MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2
ACCN NM_001161729
Insert Size 317 bp
Sequence Data
>SC203698 3’UTR clone of NM_001161729
The sequence shown below is from the reference sequence of NM_001161729. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACTGCAGAGGGAGCACCCCTCGTTGCTGAGTCCCCTCTTCCCTGGAAACCTTCCACCCAGTGCTGAAT
TTCCCTCTCTCATACCCTCCCTCCCTACCCTAACCAAGTTCCTTGGCCATGCAGAAAGCATCCCTCACC
CATCCTAGAGGCCAGGCAGGAGCCCTTCTATACCCACCCAGAATGAGACATCCAGCAGATTTCCAGCCT
TCTACTGCTCTCCTCCACCTCAACTCCGTGCTTAACCAAAGAAGCTGTACTCCGGGGGGTCTCTTCTGA
ATAAAGCAATTAGCAAATCATGTAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161729.1
Synonyms MOM1; PLA2; PLA2B; PLA2L; PLA2S; PLAS1; sPLA2
Summary The protein encoded by this gene is a member of the phospholipase A2 family (PLA2). PLA2s constitute a diverse family of enzymes with respect to sequence, function, localization, and divalent cation requirements. This gene product belongs to group II, which contains secreted form of PLA2, an extracellular enzyme that has a low molecular mass and requires calcium ions for catalysis. It catalyzes the hydrolysis of the sn-2 fatty acid acyl ester bond of phosphoglycerides, releasing free fatty acids and lysophospholipids, and thought to participate in the regulation of the phospholipid metabolism in biomembranes. Several alternatively spliced transcript variants with different 5' UTRs have been found for this gene.[provided by RefSeq, Sep 2009]
Locus ID 5320
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...