Integrin Linked Kinase (ILK) (NM_001014794) Human 3' UTR Clone

CAT#: SC203549

3' UTR clone of integrin-linked kinase (ILK) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Integrin Linked Kinase (ILK) (NM_001014794) Human 3' UTR Clone
Vector pMirTarget
Synonyms HEL-S-28; ILK-1; ILK-2; P59; p59ILK
ACCN NM_001014794
Insert Size 289 bp
Sequence Data
>SC203549 3’UTR clone of NM_001014794
The sequence shown below is from the reference sequence of NM_001014794. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCTATCCTTGAGAAGATGCAGGACAAGTAGGACTGGAAGGTCCTTGCCTGAACTCCAGAGGTGTCGGGA
CATGGTTGGGGGAATGCACCTCCCCAAAGCAGCAGGCCTCTGGTTGCCTCCCCCGCCTCCAGTCATGGT
ACTACCCCAGCCATGGGGTCCATCCCCTTCCCCCATCCCTACCACTGTGGCCCCAAGAGGGGCGGGCTC
AGAGCTTTGTCACTTGCCACATGGTGTCTCCCAACATGGGAGGGATCAGCCCCGCCTGTCACAATAAAG
TTTATTATGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001014794.3
Synonyms HEL-S-28; ILK-1; ILK-2; P59; p59ILK
Summary This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Locus ID 3611
MW 10.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...