STAT1 (NM_139266) Human 3' UTR Clone

CAT#: SC203451

3' UTR clone of signal transducer and activator of transcription 1 91kDa (STAT1) transcript variant beta for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name STAT1 (NM_139266) Human 3' UTR Clone
Vector pMirTarget
Synonyms CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
ACCN NM_139266
Insert Size 300 bp
Sequence Data
>SC203451 3’UTR clone of NM_139266
The sequence shown below is from the reference sequence of NM_139266. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGAGTTGATTTCTGTGTCTGAAGTGTAAGTGAACACAGAAGAGTGACATGTTTACAAACCTCAAGCC
AGCCTTGCTCCTGGCTGGGGCCTGTTGAAGATGCTTGTATTTTACTTTTCCATTGTAATTGCTATCGCC
ATCACAGCTGAACTTGTTGAGATCCCCGTGTTACTGCCTATCAGCATTTTACTACTTTAAAAAAAAAAA
AAAAGCCAAAAACCAAATTTGTATTTAAGGTATATAAATTTTCCCAAAACTGATACCCTTTGAAAAAGT
ATAAATAAAATGAGCAAAAGTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_139266.3
Synonyms CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91
Summary The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020]
Locus ID 6772
MW 11.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...