ATP6V1F (NM_004231) Human 3' UTR Clone

CAT#: SC203417

3' UTR clone of ATPase H+ transporting lysosomal 14kDa V1 subunit F (ATP6V1F) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ATP6V1F (NM_004231) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP6S14; VATF; Vma7
ACCN NM_004231
Insert Size 299 bp
Sequence Data
>SC203417 3’UTR clone of NM_004231
The sequence shown below is from the reference sequence of NM_004231. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCATGTTCACTGCCGAAGACCTGCGCTAGGGGACTCCTCATAGCCCTCAGCCCTTCCCTCGTTTCCAG
GCCTCTCCCCAGGCTTGCCATCAGCCTTCTTTACTTTTTGAGCCTCTGATTTCCAATTCCCTGCTCCTT
CCCACTCCATTAAGAGGCTAGGTGAGGCGCTTCTAGGTTGCTGGGGCTCTGCTGGTTAAGGAACAGGAA
GCCTGACCATCTCCCTCCACTACCTCTTCCCTGTGCTGTTACACAGTGTCATTGTTGATGTTAAATTAA
AGTCATATTCTTGCTTCTCTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004231.4
Synonyms ATP6S14; VATF; Vma7
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is the V1 domain F subunit protein. [provided by RefSeq, Jul 2008]
Locus ID 9296
MW 10.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...