HGF (NM_001010931) Human 3' UTR Clone

CAT#: SC203394

3' UTR clone of hepatocyte growth factor (hepapoietin A; scatter factor) (HGF) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name HGF (NM_001010931) Human 3' UTR Clone
Vector pMirTarget
Synonyms DFNB39; F-TCF; HGFB; HPTA; SF
ACCN NM_001010931
Insert Size 281 bp
Sequence Data
>SC203394 3’UTR clone of NM_001010931
The sequence shown below is from the reference sequence of NM_001010931. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACTGTGCAATTAAAACATGCGAGACATAACATGGGCTCTCAACTGATGGTGAACTTCTTCTGGTGAGT
GACAGAGGCTGCAGTGAAGAATAATGAGTCTAATAGAAGTTTATCACAGATGTCTCTAATCTTTATAGC
TGATCCCTACCTCTCTCGCTGTCTTTGTACCCAGCCTGCATTCTGTTTCGATCTGTCTTTTAGCAGTCC
ATACAATCATTTTTCTACATGCTGGCCCTTACCTAGCTTTTCTGAATTTACAATAAAAACTATTTTTTA
ACGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001010931.3
Synonyms DFNB39; F-TCF; HGFB; HPTA; SF
Summary This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate alpha and beta chains, which form the mature heterodimer. This protein is secreted by mesenchymal cells and acts as a multi-functional cytokine on cells of mainly epithelial origin. This protein also plays a role in angiogenesis, tumorogenesis, and tissue regeneration. Although the encoded protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Mutations in this gene are associated with nonsyndromic hearing loss. [provided by RefSeq, Nov 2015]
Locus ID 3082
MW 10.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...