ABCA6 (NM_080284) Human 3' UTR Clone

CAT#: SC203363

3' UTR clone of ATP-binding cassette sub-family A (ABC1) member 6 (ABCA6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ABCA6 (NM_080284) Human 3' UTR Clone
Vector pMirTarget
Synonyms EST155051
ACCN NM_080284
Insert Size 301 bp
Sequence Data
>SC203363 3’UTR clone of NM_080284
The sequence shown below is from the reference sequence of NM_080284. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAACTCCTCCCTCATTCAGATGAACCTTAAAACCTCAAACCTAGTAATTTTTTGTTGATCTCCTATAAA
CTCATGTTTTATGTAATAATTAATAGTATGTTTAATTTTAAAGATCATTTAAAATTAACATCAGGTATA
TTTTGTAAATTTAGTTAACAAATACATAAATTTTAAAATTATTCTTCCTCTCAAACATAGGGGTGATAG
CAAACCTGTGATAAAGGCAATACAAAATATTAGTAAAGTCACCCAAAGAGTCAGGCACTGGGTATTGTG
GAAATAAAACTATATAAACTTAGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_080284.3
Synonyms EST155051
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Locus ID 23460
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...