NHP2 (NM_017838) Human 3' UTR Clone

CAT#: SC203286

3' UTR clone of NHP2 ribonucleoprotein homolog (yeast) (NHP2) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name NHP2 (NM_017838) Human 3' UTR Clone
Vector pMirTarget
Synonyms DKCB2; NHP2P; NOLA2
ACCN NM_017838
Insert Size 280 bp
Sequence Data
>SC203286 3’UTR clone of NM_017838
The sequence shown below is from the reference sequence of NM_017838. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGTGCAGTCCCTGCCCCTACCCCTATGAGGGGCTCCGGTAGCACCTGGGCACCTGCCGCTGGAAGCT
ATTGGGCTGGCAGCAGGACGACTGGCTGTCCTCCTGCCCACCCACACTGACGGCATCTTCCCAGTTCCC
CAAGGCACGCCTTCTTCCCAGGCAGCTCTAACAGCCCTTTCATGAAGGTAATGCTAGTCTTCTGTCCAT
CAGTGCCATTTCCTGTAGAACTAAAGGCTGTTCCAAGAATGTGGGGTGGGGAAAGTAAATGCTAAGACT
AAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017838.4
Synonyms DKCB2; NHP2P; NOLA2
Summary This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Locus ID 55651
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...