ABHD12 (NM_015600) Human 3' UTR Clone

CAT#: SC203193

3' UTR clone of abhydrolase domain containing 12 (ABHD12) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ABHD12 (NM_015600) Human 3' UTR Clone
Vector pMirTarget
Synonyms ABHD12A; BEM46L2; C20orf22; dJ965G21.2; hABHD12; PHARC
ACCN NM_015600
Insert Size 260 bp
Sequence Data
>SC203193 3’UTR clone of NM_015600
The sequence shown below is from the reference sequence of NM_015600. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATCCCAGCATGTGGTCAGAGCTGGTGTGACTGAAGCCAACAGGTGACACGGTCATCGAAGAGCAGCAG
ACAAAACTAAAACTAACCCAAAGGCAGCTGAAAGTGGAGGGCAGGTGAATTCCCAGCCCTCGCCGGATT
CAACTTTTGCCAACGGTGAAGAACTGCCCTGAGCTGCAAACCTTACAAAGTCTGTAACTCTAGATAAAC
CATACCATGTGCTAACTGCACTGAAATAAAACACTAACTACATTATAATGTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015600.5
Synonyms ABHD12A; BEM46L2; C20orf22; dJ965G21.2; hABHD12; PHARC
Summary This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011]
Locus ID 26090
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...