Apc6 (CDC16) (NM_001078645) Human 3' UTR Clone

CAT#: SC203183

3' UTR clone of cell division cycle 16 homolog (S. cerevisiae) (CDC16) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Apc6 (CDC16) (NM_001078645) Human 3' UTR Clone
Vector pMirTarget
Synonyms ANAPC6; APC6; CDC16Hs; CUT9
ACCN NM_001078645
Insert Size 310 bp
Sequence Data
>SC203183 3’UTR clone of NM_001078645
The sequence shown below is from the reference sequence of NM_001078645. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGACATCTATGTCAGACCACAGCACGTGACTCCAGTCAGTGGTCCTGGTCCCACTGTCCCAGTGTAGG
TTAGTATTCCTTCACATCCTCTCCATGGCTTAAGAATGTCCCACTTCCTAACGTGACTCCAAACTGCAT
CTCTACATTTAGGAACAGAGACCCGCCTTAAGAGACTGGATCGCACACCTTTGCAACAGATGTGTTCTG
ATTCTCTGAACCTACAAAATAGTTATACATAGTGGAATAAAGAAGGTAAACCATCTGTTATGTCTTTTT
TTTTCTTTTCCAATAAACTTTTATTTTGGACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001078645.3
Synonyms ANAPC6; APC6; CDC16Hs; CUT9
Summary The protein encoded by this gene functions as a protein ubiquitin ligase and is a component of the multiprotein APC complex. The APC complex is a cyclin degradation system that governs exit from mitosis by targeting cell cycle proteins for degredation by the 26S proteasome. Each component protein of the APC complex is highly conserved among eukaryotic organisms. This protein, and other APC complex proteins, contain a tetratricopeptide repeat (TPR) domain; a protein domain that is often involved in protein-protein interactions and the assembly of multiprotein complexes. Multiple alternatively spliced transcript variants, encoding distinct proteins, have been identified. [provided by RefSeq, Jan 2016]
Locus ID 8881
MW 11.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...