VAV1 (NM_005428) Human 3' UTR Clone

CAT#: SC203138

3' UTR clone of vav 1 guanine nucleotide exchange factor (VAV1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name VAV1 (NM_005428) Human 3' UTR Clone
Vector pMirTarget
Synonyms VAV
ACCN NM_005428
Insert Size 284 bp
Sequence Data
>SC203138 3’UTR clone of NM_005428
The sequence shown below is from the reference sequence of NM_005428. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGAGGAAGATTATTCTGAATACTGCTGAGCCCTGGTGCCTTGGCAGAGAGACGAGAAACTCCAGGCT
CTGAGCCCGGCGTGGGCAGGCAGCGGAGCCAGGGGCTGTGACAGCTCCCGGCGGGTGGAGACTTTGGGA
TGGACTGGAGGAGGCCAGCGTCCAGCTGGCGGTGCTCCCGGGATGTGCCCTGACATGGTTAATTTATAA
CACCCCGATTTCCTCTTGGGTCCCCTCAAGCAGACGGGGCTCAAGGGGGTTACATTTAATAAAAGGATG
AAGATGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005428.4
Synonyms VAV
Summary This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
Locus ID 7409
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...