MED12 (NM_005120) Human 3' UTR Clone

CAT#: SC203118

3' UTR clone of mediator complex subunit 12 (MED12) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name MED12 (NM_005120) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARC240; CAGH45; FGS1; HOPA; Kto; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
ACCN NM_005120
Insert Size 262 bp
Sequence Data
>SC203118 3’UTR clone of NM_005120
The sequence shown below is from the reference sequence of NM_005120. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCAGTACCAACATATTTGGACGCTACTGAGCCACCTGGAGGAACTGCTTGTGCACTGGATGTGGCCCC
ACCCTTTCCTCTTAATTCCCAATCCCATTCCTGGGCTAGCACCAGTAGTGGTTGGGGCCCTCCCCTCAG
GCTCCATTTTTAATAAGTTTTTAGTATTTTTGTTAATGTGAGGCATTGAGCTGTTGGGTTTTGTATATT
ATTTATATAGAGACCCCAGAGCTGTTGCACCCAATACACAGAGCTTCTTTGCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005120.3
Synonyms ARC240; CAGH45; FGS1; HOPA; Kto; MED12S; OHDOX; OKS; OPA1; TNRC11; TRAP230
Summary The initiation of transcription is controlled in part by a large protein assembly known as the preinitiation complex. A component of this preinitiation complex is a 1.2 MDa protein aggregate called Mediator. This Mediator component binds with a CDK8 subcomplex which contains the protein encoded by this gene, mediator complex subunit 12 (MED12), along with MED13, CDK8 kinase, and cyclin C. The CDK8 subcomplex modulates Mediator-polymerase II interactions and thereby regulates transcription initiation and reinitation rates. The MED12 protein is essential for activating CDK8 kinase. Defects in this gene cause X-linked Opitz-Kaveggia syndrome, also known as FG syndrome, and Lujan-Fryns syndrome. [provided by RefSeq, Aug 2009]
Locus ID 9968
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...