Aldolase (ALDOA) (NM_184043) Human 3' UTR Clone

CAT#: SC203101

3' UTR clone of aldolase A fructose-bisphosphate (ALDOA) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Aldolase (ALDOA) (NM_184043) Human 3' UTR Clone
Vector pMirTarget
Synonyms ALDA; GSD12; HEL-S-87p
ACCN NM_184043
Insert Size 256 bp
Sequence Data
>SC203101 3’UTR clone of NM_184043
The sequence shown below is from the reference sequence of NM_184043. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCTCTTCGTCTCTAACCACGCCTATTAAGCGGAGGTGTTCCCAGGCTGCCCCCAACACTCCAGGCCC
TGCCCCCTCCCACTCTTGAAGAGGAGGCCGCCTCCTCGGGGCTCCAGGCTGGCTTGCCCGCGCTCTTTC
TTCCCTCGTGACAGTGGTGTGTGGTGTCGTCTGTGAATGCTAAGTCCATCACCCTTTCCGGCACACTGC
CAAATAAACAGCTATTTAAGGGGGAGTCGGCAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_184043.2
Synonyms ALDA; GSD12; HEL-S-87p
Summary This gene encodes a member of the class I fructose-bisphosphate aldolase protein family. The encoded protein is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate. Three aldolase isozymes (A, B, and C), encoded by three different genes, are differentially expressed during development. Mutations in this gene have been associated with Glycogen Storage Disease XII, an autosomal recessive disorder associated with hemolytic anemia. Disruption of this gene also plays a role in the progression of multiple types of cancers. Related pseudogenes have been identified on chromosomes 3 and 10. [provided by RefSeq, Sep 2017]
Locus ID 226
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...