P70 S6 Kinase beta (RPS6KB2) (NM_003952) Human 3' UTR Clone

CAT#: SC203095

3' UTR clone of ribosomal protein S6 kinase 70kDa polypeptide 2 (RPS6KB2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name P70 S6 Kinase beta (RPS6KB2) (NM_003952) Human 3' UTR Clone
Vector pMirTarget
Synonyms KLS; p70(S6K)-beta; P70-beta; P70-beta-1; P70-beta-2; p70S6Kb; S6K-beta2; S6K2; S6KB; S6Kbeta; S6KI(2); SRK; STK14B
ACCN NM_003952
Insert Size 262 bp
Sequence Data
>SC203095 3’UTR clone of NM_003952
The sequence shown below is from the reference sequence of NM_003952. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAGGGGCCGTGGGCGTCCAGGGCGCTAGGAAGCCGGGTGGGGGTGAGGGTAGCCCTTGAGCCCTGTC
CCTGCGGCTGTGAGAGCAGCAGGACCCTGGGCCAGTTCCAGAGACCTGGGGGTGTGTCTGGGGGTGGGG
TGTGAGTGCGTATGAAAGTGTGTGTCTGCTGGGGCAGCTGTGCCCCTGAATCATGGGCACGGAGGGCCG
CCCGCCACGCCCCGCGCTCAACTGCTCCCGTGGAAGATTAAAGGGCTGAATCATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003952.3
Synonyms KLS; p70(S6K)-beta; P70-beta; P70-beta-1; P70-beta-2; p70S6Kb; S6K-beta2; S6K2; S6KB; S6Kbeta; S6KI(2); SRK; STK14B
Summary This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains a kinase catalytic domain and phosphorylates the S6 ribosomal protein and eukaryotic translation initiation factor 4B (eIF4B). Phosphorylation of S6 leads to an increase in protein synthesis and cell proliferation. [provided by RefSeq, Jan 2015]
Locus ID 6199
MW 8.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...