Integrin beta 7 (ITGB7) (NM_000889) Human 3' UTR Clone

CAT#: SC203071

3' UTR clone of integrin beta 7 (ITGB7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Integrin beta 7 (ITGB7) (NM_000889) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_000889
Insert Size 263 bp
Sequence Data
>SC203071 3’UTR clone of NM_000889
The sequence shown below is from the reference sequence of NM_000889. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTCAAGAGGCAGACAGTCCCACTCTCTGAAGGAGGGAGGGACACTTACCCAAGGCTCTTCTCCTTGGA
GGACAGTGGGAACTGGAGGGTGAGAGGAAGGGTGGGTCTGTAAGACCTTGGTAGGGGACTAATTCACTG
GCGAGGTGCGGCCACCACCCTACTTCATTTTCAGAGTGACACCCAAGAGGGCTGCTTCCCATGCCTGCA
ACCTTGCATCCATCTGGGCTACCCCACCCAAGTATACAATAAAGTCTTACCTCAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000889.3
Summary This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Locus ID 3695
MW 9.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...