eNOS (NOS3) (NM_001160109) Human 3' UTR Clone

CAT#: SC203053

3' UTR clone of nitric oxide synthase 3 (endothelial cell) (NOS3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name eNOS (NOS3) (NM_001160109) Human 3' UTR Clone
Vector pMirTarget
Synonyms ECNOS; eNOS
ACCN NM_001160109
Insert Size 275 bp
Sequence Data
>SC203053 3’UTR clone of NM_001160109
The sequence shown below is from the reference sequence of NM_001160109. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCCAGAAGTGTCTGTCACCACAGAATAGTTTCGCCTGCTCTAGAACGGCACCTAGATGGAAGCACGC
AGTGTTGCGGCGTCTCCTGCTGAGGCTGTTTTTGAGGCGCACTCGTGTTGCTGCGTGACTCAGTATTTC
ACTCATTCTGCTGCTGAGTGCCGTTCATTGTGTGAATATCCCCAGTTTGTTTACCCATTCTCTTGTTGG
TGACACTTGGGCTGTTTCCAGGTCGGGGCTATTATGAATAAACCTGTTATGAACATTCTTGTACCCGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001160109.2
Synonyms ECNOS; eNOS
Summary Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Locus ID 4846
MW 10.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...