Cytokeratin 8 (KRT8) (NM_002273) Human 3' UTR Clone

CAT#: SC203044

3' UTR clone of keratin 8 (KRT8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Cytokeratin 8 (KRT8) (NM_002273) Human 3' UTR Clone
Vector pMirTarget
Synonyms CARD2; CK-8; CK8; CYK8; K2C8; K8; KO
ACCN NM_002273
Insert Size 267 bp
Sequence Data
>SC203044 3’UTR clone of NM_002273
The sequence shown below is from the reference sequence of NM_002273. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTGAGTCCTCTGACGTCCTGCCCAAGTGAACAGCTGCGGCAGCCCCTCCCAGCCTACCCCTCCTGCGC
TGCCCCAGAGCCTGGGAAGGAGGCCGCTATGCAGGGTAGCACTGGGAACAGGAGACCCACCTGAGGCTC
AGCCCTAGCCCTCAGCCCACCTGGGGAGTTTACTACCTGGGGACCCCCCTTGCCCATGCCTCCAGCTAC
AAAACAATTCAATTGCTTTTTTTTTTTGGTCCAAAATAAAACCTCAGCTAGCTCTGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002273.4
Synonyms CARD2; CK-8; CK8; CYK8; K2C8; K8; KO
Summary This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Locus ID 3856
MW 9.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...