Factor H (CFH) (NM_001014975) Human 3' UTR Clone

CAT#: SC203011

3' UTR clone of complement factor H (CFH) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Factor H (CFH) (NM_001014975) Human 3' UTR Clone
Vector pMirTarget
Synonyms AHUS1; AMBP1; ARMD4; ARMS1; CFHL3; FH; FHL1; HF; HF1; HF2; HUS
ACCN NM_001014975
Insert Size 265 bp
Sequence Data
>SC203011 3’UTR clone of NM_001014975
The sequence shown below is from the reference sequence of NM_001014975. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGATGCATCCGTGTCAGCTTTACCCTCTGAACTTCTGATCGAAGGTCATCCCTCTCCAGCTTGAGTGGA
TCAAAGATGACAAGGGCCAATGGAACCAAGTTTGAGTCTTGCCAGGTCAATACTTGGGTCCTGAGTATG
GTGACTAGTATCTGTTTTGTTATGTGTGTATTATTCCAGCCAGAATGGGAAATGCTAATTCAGCTCCTC
CAGGCAGCCCAATGGGGCTGGTGGCTTTGAGATTATTAAACTCTTTCTCTGCTGCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001014975.3
Synonyms AHUS1; AMBP1; ARMD4; ARMS1; CFHL3; FH; FHL1; HF; HF1; HF2; HUS
Summary This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
Locus ID 3075
MW 10.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...