Kv4.3 (KCND3) (NM_172198) Human 3' UTR Clone

CAT#: SC203007

3' UTR clone of potassium voltage-gated channel Shal-related subfamily member 3 (KCND3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5,464.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Kv4.3 (KCND3) (NM_172198) Human 3' UTR Clone
Vector pMirTarget
Synonyms BRGDA9; KCND3L; KCND3S; KSHIVB; KV4.3; SCA19; SCA22
ACCN NM_172198
Insert Size 259 bp
Sequence Data
>SC203007 3' UTR clone of NM_172198
The sequence shown below is from the reference sequence of NM_172198. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTTCCATAGCCAGCAATGTTGTCAAGGTCTCCGCCTTGTAAAACCACTGGACAGAGGGCCAGAGTGGGT
AGTGGGGAATGAAGGGGACTGGCATGTTGGTGGGTGGTCACTGAGACCACTCCCTCCCCCCTTTCCCCAC
TATTTCTGCCTGCCCCATTGTACCCCTAGCACTGAGACTTGTGCCTGGAAGGAAAAAGAGGTAGCAAAGG
GGCACCTGAGGTTCACGCTGCTAGCGTGGACATAGCCCTGTGATACTGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_172198.1
Synonyms BRGDA9; KCND3L; KCND3S; KSHIVB; KV4.3; SCA19; SCA22
Summary Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member includes two isoforms with different sizes, which are encoded by alternatively spliced transcript variants of this gene. [provided by RefSeq, Jul 2008]
Locus ID 3752
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...