SF3B4 (NM_005850) Human 3' UTR Clone

CAT#: SC202993

3' UTR clone of splicing factor 3b subunit 4 49kDa (SF3B4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SF3B4 (NM_005850) Human 3' UTR Clone
Vector pMirTarget
Synonyms AFD1; Hsh49; SAP49; SF3b49
ACCN NM_005850
Insert Size 255 bp
Sequence Data
>SC202993 3’UTR clone of NM_005850
The sequence shown below is from the reference sequence of NM_005850. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCCACTTCGAGGCCCTCTCCCTCAGTAAATTCACATTTTCCTTCCTCCTGTTACATTTTCCCAATAT
CTTTTCTATTCCTTGGACCAATCAGAGATGCTGTAGCTCCTTGGGGCAAAGGTACTAATCCCTTTCAGC
ACCCCCACTCCATTCCCCTTTTTAATGTAACTTTTTCCACAGGAGGTATTTCTTTTTTATGTTGGTCCT
GAGTATTTTGCAAATGCACAGAGAAAATAAAACTAAACTCCTTGTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005850.5
Synonyms AFD1; Hsh49; SAP49; SF3b49
Summary This gene encodes one of four subunits of the splicing factor 3B. The protein encoded by this gene cross-links to a region in the pre-mRNA immediately upstream of the branchpoint sequence in pre-mRNA in the prespliceosomal complex A. It also may be involved in the assembly of the B, C and E spliceosomal complexes. In addition to RNA-binding activity, this protein interacts directly and highly specifically with subunit 2 of the splicing factor 3B. This protein contains two N-terminal RNA-recognition motifs (RRMs), consistent with the observation that it binds directly to pre-mRNA. [provided by RefSeq, Jul 2008]
Locus ID 10262
MW 9.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...