Frataxin (FXN) (NM_001161706) Human 3' UTR Clone

CAT#: SC202986

3' UTR clone of frataxin (FXN) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Frataxin (FXN) (NM_001161706) Human 3' UTR Clone
Vector pMirTarget
Synonyms CyaY; FA; FARR; FRDA; X25
ACCN NM_001161706
Insert Size 274 bp
Sequence Data
>SC202986 3’UTR clone of NM_001161706
The sequence shown below is from the reference sequence of NM_001161706. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACGTGGCTCCTGTGGCTGTTCCATCCCTGAGGAAAAGTGAGGACCATGCTCTCCAAACAGGCCATGTGC
TGGACTACCTCTGTTTCTGTCTCCTGGGATTCCAATCAGCAAGTGAGCAACGAAGCAACCCAGACAGTG
TGGTTCATAGGATGGCTGGGTAAGTGGCTGTTTGTTTTTTCCTTACTGTGGATATGTATCAGTGAAGGA
ATCTGTAGAACATTCTTGATGGGAACATTTAGTCATATCAAGTCAATAAATTAATGTTTAGGCTGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001161706.1
Synonyms CyaY; FA; FARR; FRDA; X25
Summary This nuclear gene encodes a mitochondrial protein which belongs to the FRATAXIN family. The protein functions in regulating mitochondrial iron transport and respiration. The expansion of intronic trinucleotide repeat GAA from 8-33 repeats to >90 repeats results in Friedreich ataxia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Locus ID 2395
MW 10.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...